You can write your love letter in……DNA.

1. Save the above scripts like ‘translate.py’
2. change permission

chmod +x translate.py

3. compose your love letter or something in ‘plain english’ and save it as text. Let’s assume you wrote something like this

I love you so much, babe..

4. Then execute the script.

./translate.py love.txt
>Iloveyousomuchbabe
ATGATTTTATAGGTTGAATATTAGTGATCTTAGATGTGATGTCATGTGGCTGTGGAATAA

Now you have a functional ‘gene’ for your ‘love letter’!. Even it will be translated in the cell cause it has start and stop codon.

2 thoughts on “You can write your love letter in……DNA.

  1. This will ensure the longevity of the panel by making it stronger
    and protecting its surface from the environmental factors.
    Oral application of aloe is gaining popularity because the gel has the ability to promote healing
    against mouth ulcers, which occur in 15 to 20 percent of the population,
    and have been resistant to conventional approaches
    to treatment. In another study researchers found that lower blood levels of vitamin D in children were linked to allergy and asthma severity.

Leave a Reply

Fill in your details below or click an icon to log in:

WordPress.com Logo

You are commenting using your WordPress.com account. Log Out / Change )

Twitter picture

You are commenting using your Twitter account. Log Out / Change )

Facebook photo

You are commenting using your Facebook account. Log Out / Change )

Google+ photo

You are commenting using your Google+ account. Log Out / Change )

Connecting to %s